circad | circRNAs associated with diseases

hsa_circ_0058106
Gene	FN1	Organism	Human
Genome Locus	chr2:216246934-216248907:-	Build	hg19
Disease	Hypopharyngeal Squamous Cell Carcinoma	ICD-10	Malignant neoplasm of hypopharynx (C13)
DBLink	Link to database	PMID	28514762
Experimental Method
Sample Type	Tissues	Comparison	Tumor tissues and paired adjacent normal tissues were obtained from 36 patients
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTGCAGGTCCAGATCAAACA Reverse GTTTAAGGCCGCTGATGGTA	Statistics	Fold Change : Upregulated,26.222 pvalue : p=0.014
Citation
Cao, S, Wei, D, Li, X, Zhou, J, Li, W, Qian, Y, Wang, Z, Li, G, Pan, X, Lei, D (2017). Novel circular RNA expression profiles reflect progression of patients with hypopharyngeal squamous cell carcinoma. Oncotarget, 8, 28:45367-45379.